Groß- und Kleinschreibung

zorro0369

Mitglied
Mitglied seit
25 Mrz 2018
Beiträge
406
Punkte für Reaktionen
94
Punkte
28
Ist das sein Ausdruck von Disrespekt
wie ich was schreibe, ist grundsätzlich meine sache. aber um dich u.U. weiterzubringen, informier dich mal über anstandsformen des geschriebenen wortes im internet.
ich nörgel ja auch nicht über deine rechtschreibfehler;).

lg zorro

Edit DM41: Diskussion aus dem ursprünglichen Thema abgetrennt.
 
Zuletzt bearbeitet von einem Moderator:

PeterPawn

IPPF-Urgestein
Mitglied seit
10 Mai 2006
Beiträge
13,764
Punkte für Reaktionen
1,260
Punkte
113
Spell, punctuate, and capitalize correctly. Don't confuse “its” with “it's”, “loose” with “lose”, or “discrete” with “discreet”. Don't TYPE IN ALL CAPS; this is read as shouting and considered rude. (All-smalls is only slightly less annoying, as it's difficult to read. Alan Cox can get away with it, but you can't.)
aus: http://www.catb.org/~esr/faqs/smart-questions.html

Verwende korrekte Rechtschreibung, Interpunktion und Großschreibung. Schreibe NICHT ALLES GROSS, das wird als Schreien empfunden und gilt als unhöflich. (Vollständige Kleinschreibung ist einen Deut weniger nervtötend, ist aber auch schwer zu lesen. Einem Alan Cox wird man so etwas vielleicht durchgehen lassen – dir nicht.)
aus: https://tty1.net/smart-questions_de.html#writewell

Nun bezieht sich beides zwar - streng genommen - nur auf die Art und Weise, wie man selbst Fragen stellt ... aber der "Grundtenor", daß permanente Kleinschreibung schwerer zu lesen ist (und auch zu - manchmal skurilen - Mißverständnissen führen kann, wenn nicht mehr zwischen Substantiven und anderen Wortformen unterschieden werden kann), der trifft ja nicht nur auf Fragesätze zu.

Was wären denn ansonsten die erwähnten "anstandsformen des geschriebenen wortes im internet" bzw. welche Quellen (mit entsprechender Zustimmung) beschreiben denn, daß man besser generell auf die Verwendung von Großbuchstaben verzichten sollte?

Ich kenne es z.B. von diversen Smartphone- und Tablet-OS sogar so, daß die schlauer sein wollen, als die Besitzer der jeweiligen Geräte (manchmal erscheint das auch nicht sehr schwierig) und nach einem Satzzeichen (Punkt, Ausrufungs- und Fragezeichen) automatisch auf Großschreibung umschalten (auch wenn man das üblicherweise ändern kann in den Einstellungen, ist es doch erst einmal der voreingestellte Standard, afaik). Ist das auch immer die erste Aktion bei der Neueinrichtung eines Gerätes, die man dann machen muß, wenn man sich für das regelwidrige Schreiben als "Kunstform" entschieden hat oder nimmt man den Mehraufwand in Kauf, da jedesmal wieder manuell auf Kleinschreibung zu schalten ... wie ich es häufig nach der Verwendung von "Auslassungspunkten" (https://de.wikipedia.org/wiki/Auslassungspunkte) machen muß?

Ich finde also auch, daß es schon nervig ist ... nur läßt man es jemandem, der sich über längere Zeit auch aktiv beteiligt, wohl eher durchgehen (auch weil man es vermutlich mit Argumenten gar nicht (mehr) ändern kann - ein alter Hund lernt eben keine neuen Tricks mehr), als jemandem, der gleich von Beginn an mit dieser Attitüde hier aufläuft, daß doch bitteschön alle Welt sein eher gespaltenes Verhältnis zur Höflichkeit (und ja, es gehört zur Höflichkeit dazu, daß man es einem Leser so einfach wie möglich macht, die eigenen Texte auch zu lesen, solange diese korrekte Sprache benutzen) und zu korrekter Schreibweise akzeptieren möge.

Ich bin ja der Ansicht, daß heutzutage fast alles auch online nachzulesen ist und daher die Grenze mit "im internet" nur schwach definiert wird ... und ich stelle mir gerade (mit Grauen) vor, wie das wohl wäre, wenn sich z.B. die Autoren bei heise.de auch auf diese Art und Weise selbst verwirklichen wollten. Wer es mal ausprobieren möchte ... ein paar wenige Handgriffe (etwas zusätzlicher JS-Code) machen aus jedem korrekt geschriebenen Artikel auch wieder eine Buchstabenwüste.
 

zorro0369

Mitglied
Mitglied seit
25 Mrz 2018
Beiträge
406
Punkte für Reaktionen
94
Punkte
28
vielleicht akzeptierst du ja einen unserer größten dichter, ich zitiere:
Es ist nicht zu spät, und leicht genug, einer so peinlichen und unnützen schreibweise zu entsagen, welche sich von uns lediglich Dänen und Litthauer haben aufbürden lassen, Schweden und Engländer bald nach den ersten versuchen, in richtigerem tact und gesunderem sprachgefühl, wieder ablegten. selbst in unsrer mitte ist sie nie völlig durchgedrungen: es gab noch im 17 und 18 jh. schriftsteller, die mit verschmähung der neuerung die althergebrachte einfachheit nicht verjähren ließen.wer große buchstaben für den anlaut der substantive schreibt, schreibt pedantisch.
Jacob Grimm

und es gibt noch mehr quellen zum thema kleinschreibung.
allerdings meinte ich mit anstandsformen etwas anderes. dieses belanglose diskreditieren anderer, weil die einen anderen stil haben, dies aber selber nicht in vernünftiger form darbieten zu können (alles gross geschrieben und dann auch noch rechtschreibfehler darin).
oder nun bei dir :
als jemandem, der gleich von Beginn an mit dieser Attitüde hier aufläuft, daß doch bitteschön alle Welt sein eher gespaltenes Verhältnis zur Höflichkeit
mir ein gespaltenes verhältnis zur höflichkeit darin vorzuwerfen, ist schon ein starkes stück. nur weil du es so empfindest. es mag für dich unhöflich sein, das nehm ich dir unbesehen ab. aber dies zu verallgemeinern stößt mir dann böse auf :( .
dachte in einem forum kommt es auf den inhalt des postes an, nicht auf u.U. andere stilformen, die nur weil man sie nicht kennt oder akzeptieren will, nichts aber auch gar nichts mit höflichkeit zu tun haben.
während oberlehrer-verhalten und "anschreien" durch großbuchstaben garantiert unhöflich ist.
btw, ich schreibe so schon seit ´87 im internet. und in der regel wird es so akzeptiert. geschäftsbriefe werden natürlich der deutschen grammatik entsprechend geschrieben, wobei ich auch hier hoffe, dass die englischen regeln irgendwann mal übernommen werden....

lg zorro
 

koyaanisqatsi

IPPF-Urgestein
Mitglied seit
24 Jan 2013
Beiträge
13,338
Punkte für Reaktionen
457
Punkte
83
@PeterPawn - Ein Blick in die Zukunft...
Code:
GTACTACACATGCTACTCTACCTAAGCTCGTGTCACCACCTATCGTAGCTAAGCCACCTATCACGTTAGTGATCACGTCACCTACTGCATGATCTCGTC,AGCCTGCTCTAGCTACACGAGGATCTCTCGTAGCTGTGTCTCAGCGATCTCTACAGCGTCCACTGTßTGATCACGTCACCTACTGCATGATCTCGTCACGAGCTGATCACGTCACCTACTGCATCTAAGCCTCCTGTCACGTTAGAGCACTATCATCCTATGAAGCGTCCACTGTTGATGA,AGCTACACTTGAAGCATGCTGCACTACAGCACTATCTGAAGCTGATCACGTCACCTACTGCTACTCAGCCTAACAGAGGCTGATCTCTACCTACTCAGCGATCTCTACAGCGTCCTGATCTAGAGCACTATCTGAAGCGATCTCCGTöGCTATCCTGTCACGTACGAGC(GTATGTATCATCTGATAGäCTCTACCTGGTCCTAAGCTCGATCCTACTGCTCTGATCACGTCACCTACTGCATGATCTCGTCAGCCTGTGATAGAGCCTACTGCTCCTACTCAGCTACCTAGATTAGAGCATGCTACTCCTGGTCCTACACAGCCTCCTACACGTATAGöTAGCTACTCTAC,AGCCTGTGATAGAGCACTCATCTACACAGCACTGATTCACGTAGCTGATCACGTATGCTACACAGCGCAGATAGCATCCTATGACTACTCACGAGCCTACTGCTCCTAACAAGCACTATCACTCTCAGCTCATGTAGTAGCATGCTGCACTACAGCACAACTCTCAGCTGATGTAGCCTATAGATGACTTGAAGCGTACTGCTAATCATCCTACTGTCACGTTAGAGCTACGATCACTCACGTGTCCTACGTCTACTCAGCATCACTTGATGACTACTCAGC–AGCTACCTGCACAGCCTCCTGTCACGTTAGACG)
( Deutsche Übersetzung deines Zitats in DNA Code kodiert )
DNA CODE SCHREIT!!!
 

PeterPawn

IPPF-Urgestein
Mitglied seit
10 Mai 2006
Beiträge
13,764
Punkte für Reaktionen
1,260
Punkte
113
Abseits von Jacob Grimm und der Frage, ob wir - angesichts unserer kulturellen Wurzeln - dann nicht auch weiterhin Mittelhochdeutsch schreiben und reden müßten oder sollten ... ich meinte schon Quellen, die etwas näher an der Gegenwart und der Vereinheitlichung der deutschen Sprache (die nebenbei auch einen Beitrag bei der Beendingung der deutschen Kleinstaaterei leistete) liegen - und zu einer "Quellenangabe" gehört nicht nur der Name dessen, der da "zitiert" wird, sondern auch ein entsprechender Link (das dürfte heute nicht sooo schwer sein, früher war es der passende "Literaturverweis" und der war schwerer zu erbringen (schon mit der Suche nach der richtigen Seite) und schwerer zu verfolgen).

Ich will auch die Größe von Jacob Grimm nicht schmälern (wer wäre ich denn, daß ich mir dieses erlaubte) ... aber weder er noch andere Künstler waren bisher eine "überzeugende Mehrheit" und auch die Protagonisten einer gemäßigten Kleinschreibung (die deutlich weniger radikal ist, als das was Du schreibst), konnten sich nicht wirklich durchsetzen. Damit bleibt aber nun mal diese Art des Schreibens etwas für "Nonkonformisten", die sich damit auch - willentlich - von "der Masse" abheben wollen - und das ist zwar legitim, aber noch lange kein Grund, auf Nachfragen dazu dann "verschnupft" zu reagieren, anstatt es einfach zu erklären (wenn man sich tatsächlich etwas dabei denkt).

Die Regeln, die Konrad Duden niederschrieb, stammen aus dem Jahre 1871 und der erste "Gesamt-Duden" erschien 1880 - da waren die beiden Grimm-Brüder bereits tot. Und es ist nun mal (hoffe ich jedenfalls) unstrittig, daß es eine einheitliche deutsche Rechtschreibung gibt - und wohl auch schon zu Lebzeiten all derer, die sich hier heute noch äußern können, bereits gab. Da wurden dann ein paar Regeln verändert ... DAS muß man tatsächlich auch in meinen Augen nicht zwingend mitgehen, zumal diese Reform sich durch wiederholte Änderungen letztlich selbst diskreditierte (zumindest in meinen Augen).

Wenn Du also netterweise noch mehr Quellen zum Thema Kleinschreibung anführen würdest? Aber bitte auch welche, die zumindest aus dem 20. Jahrhundert stammen - denn viel älter ist das Internet meines Wissens nicht. Wobei ich auch nicht nach Quellen von Befürwortern einer (gemäßigten) Kleinschreibung fragte (die finde ich schon selbst) ... ich meinte schon ein Pendant zu den von mir verlinkten "Netiquetten", in dem davon die Rede wäre, daß man auf Großschreibung generell verzichten sollte. Denn ich beziehe mich bei dieser Frage ja auch ausdrücklich auf das, was Du selbst da geschreiben hast, wenn ich meinerseits frage:
Was wären denn ansonsten die erwähnten "anstandsformen des geschriebenen wortes im internet" bzw. welche Quellen (mit entsprechender Zustimmung) beschreiben denn, daß man besser generell auf die Verwendung von Großbuchstaben verzichten sollte?
Das kann also - wenn es um "anstandsformen des geschriebenen wortes im internet" geht - nicht Jacob Grimm sein, denn der kannte das Internet noch nicht und selbst die Kommissionsmitglieder, die bei der ersten Rechtschreibreform 1996 mitwirkten, dürften eher selten schon etwas vom Internet (in seiner heutigen Form) gehört haben, sich mithin auch dazu keine Gedanken gemacht haben.

Und ich fand es auch 1987 1990 schon im FidoNet nervig, wenn jemand nur klein schrieb - und offenbar ja auch nicht nur ich, denn die von mir verlinkten "Benimmregeln" waren lange Zeit - gerade als sich überwiegend "Interessierte" online trafen und für die meisten das Internet noch die (einzige) Konnotation "Porno" hatte - ein ziemlich verbreiteter Konsens, ihre Autoren (das sind ja auch mehrere) waren jetzt auch keine Sprachwissenschaftler, die unbedingt ihrer Profession frönen wollten, sondern nur Leute, die sich auch ständig mit solchen Beiträgen/Fragen konfrontiert sahen, die sie dann entweder entsprechend kommentierten oder eben auch ignorierten. Trotzdem wurde das Original bis ins letzte Jahrzehnt hinein (da gab es auch schon "social media" und deren Auswirkungen auf andere Internet-Dienste) immer wieder aktualisiert und in viele verschiedene Sprachen übersetzt.

Ja, die Frage der Kleinschreibung wurde (und wird) auch immer mal diskutiert (https://de.wikipedia.org/wiki/Kleinschreibung) - nur ist es dann eben (fast immer) ein künstlerischer Ausdruck/Anspruch, der damit verbunden wird oder auch eine politische Idee/Aussage. Aber das, was Du in #608 suggerierst, ist nun mal, daß das zu den "anstandsformen des geschriebenen wortes im internet" gehören würde und dem widerspreche ich (und nicht nur ich), zumal Du ja auch - anders als viele andere Verfechter dieser Idee - gar nicht die gemäßigte, sondern die konsequente Kleinschreibung verwendest, die es auch heute noch in fast keiner Sprache (anders als bei der gemäßigten KS) gibt.

Abgesehen davon finde ich die Aussage
allerdings meinte ich mit anstandsformen etwas anderes
verwirrend ... denn bei Dir ist ja explizit von den "anstandformen des geschriebenen wortes im internet" (exakte Wiedergabe Deiner Worte) die Rede und wie genau unterschieden sich die Anstandsformen jetzt, wenn das nicht im Internet und/oder das geschriebene, sondern ein gesprochenes Wort wäre?

Und zu Deiner Frage, warum ich das unhöflich finde ... es gibt auch für dieses Board gewisse Regeln und da ist nun mal auch eine korrekte Schreibweise hinterlegt - und alle hier (einschließlich Dir) haben diese Regeln zumindest konkludent akzeptiert. Wenn das jemandem von Beginn an nicht paßte ... niemand hat ihn/sie vermutlich gezwungen, sich der Community dann trotzdem anzuschließen.

Wer sich jetzt dann aber spontan von dieser Gruppe und dem geschlossenen Konsens löst, der interessiert sich ja ganz offensichtlich mehr für seine eigenen Belange (und will nach seinen eigenen Regeln handeln), als für die der anderen. Wenn jemand damit nicht einverstanden ist, kann/darf/soll er das in meinen Augen dann auch deutlich ansprechen (ja, gar kritisieren) und dann sollte man als der Kritisierte seine eigene Ansicht etwas ausführlicher (und auch etwas netter und höflicher, gerade dann, wenn man der Ansicht ist, man hätte schon gute und (für andere) nachvollziehbare Gründe dafür) darlegen, als das in #608 der Fall war/ist. Denn ein "ich nörgel ja auch nicht über deine rechtschreibfehler" ist alles andere, nur kein (sachliches) Argument dafür, warum man selbst der Ansicht ist, man schreibt lieber alles klein.

Denn in einem anderen Punkt gebe ich Dir auch recht ... es ist tatsächlich wichtiger, was IN einem Beitrag steht, als WIE es geschrieben wurde - nur schreibst Du ja selbst (später im nächsten Beitrag), daß Du das als "Stilmittel" interpretiert wissen willst. Warum dann noch der Hinweis an den (ursprünglichen) Fragesteller, daß er seinerseits dafür weiterhin Rechtschreibfehler machen darf?
 
Zuletzt bearbeitet:

zorro0369

Mitglied
Mitglied seit
25 Mrz 2018
Beiträge
406
Punkte für Reaktionen
94
Punkte
28
du machst es mir echt schwer ;), deswegen fang ich mal hinten an, denn damit fing alles an......

reine großschreibung wird zurecht überall als anschreien angesehen, nun ich wurde angeschrien. vollkommen ohne grund, da ich "nur" versuch habe etwas oberhalb einem fragesteller zu antworten. dass ich dann etwas sauer bin (hätte mich an die BW regeln erinnern sollen, erst nach 24std zu antworten), sollte mir wohl zugesanden werden, deswegen die bemerkung mit dem schreibfehler, der ja in dem großbuchstabenbereich war. wie üblich natürlich schon wieder gelöscht, hätte wohl besser ein fullquote machen sollen. wird eh hier viel zu viel gelöscht, sobald kritik auftaucht, na ja sei´s drum....
anstandformen des geschriebenen wortes im internet
genau dies meinte ich mit anstand, anschreien ist immer falsch, wird auch nicht richtig, selbst wenn man recht haben sollte....

boardregeln? *hüstel*. erstens steht es weder dir noch mir zu andere versuchen deswegen öffentlich zu "diziplinieren" (extra in "", weil mir fiel nix anderes gerade ein), wie es hier soviele machen (deine sig zu lang etc...), zweitens, wir sind hier im dect repeater/smart-home-bereich, schau mal wieviele themen hier für w-lan, tasmota o.ä. sind, die rein gar nix mit dem unterforum zu tun haben. ich denke die board regeln sind im günstigsten fall "lebendig" :cool:.
die bei der ersten Rechtschreibreform 1996 mitwirkten, dürften eher selten schon etwas vom Internet
und ich behaupte das gegenteil, da einige mitglieder aufgrund dessen die kommision verlassen haben, weil es nicht zumindest eine gemäßigte kleinschreibung gab. wer jetzt von uns beiden recht hat, denke dies werden wir erst nach ausführlicher studie aller beteiligten samt background feststellen können.

mittelhochdeutsch reden ja, ohne frage, und ja, das deutsche (als sprache, ganz wichtig!, nicht wie es manche ewig gestrige meinen) hat zur einigung der kleinstaaten geführt ( preussen hat natürlich durch bismark sein übriges getan, aber 48 war es nur die sprache). doch die schrift, die ändert sich, wie das word. bin ich ein ninkonformist, bestimmt! will ich mich von der masse abheben, hier bestimmt nicht, das bin einfach ich, ich mach mir gar keine gedanken darüber, so bin ich einfach.

zur quellenangabe... ok... Jacob Grimm, Deutsche grammatik von 1840.

nun bin ich oben an deinem erstem zitat von mir und springe wieder an meinen anfang dieses postes, ich lass mich nicht anschreien, das hat was mit anstand zu tun...

@Ralf-Fritz sorry, du hast ja recht ;) , könntest du bitte, wenn nicht schon geschehen die firmware der telekom bulbs han fun aktualisieren? https://www.ip-phone-forum.de/threa...n-fritz-boxen-integrieren.290672/post-2417906

lg zorro
 

PeterPawn

IPPF-Urgestein
Mitglied seit
10 Mai 2006
Beiträge
13,764
Punkte für Reaktionen
1,260
Punkte
113
Ich bin letztlich tatsächlich nur auf Deinen Beitrag eingestiegen, weil da das (zuvor schon zitierte) Satzfragment zu lesen war und weil mir das "selber!" (angesichts dessen, was Du sonst schreibst) zu kindisch vorkam.

nun ich wurde angeschrien. vollkommen ohne grund
In Deiner Replik an @Olaf Ligor kann man auch nicht erkennen, wo dieses "Anschreien" erfolgt ist - es sei denn, Du meintest die ausschließliche Großschreibung vor der (ggf. auch rhetorischen) Frage, die Du dann zitiert hast ... aber daß es da gar nicht darum ging, "zu schreien", sondern lediglich das Gegenteil des von Dir verwendeten Stils zu zeigen (auch wenn das als Schreien angesehen wird), sollte eigentlich auch klar erkennbar gewesen sein (mittlerweile fehlt dieser Beitrag ganz) und ich verstehe nicht, wie Du daraus jetzt ein Anschreien in Deine Richtung ablesen kannst, das Dich dann Anstandsformen ventilieren läßt.

Ich weiß auch nicht, was hier Deiner "Auseinandersetzung" mit @Olaf Ligor vorausging und ob das irgendwelche Relevanz hatte ... wenn ich da nicht bis zur Steinzeit zurückgehe (#597 (im anderen Thread) ist schon 20.02.2021), sehe ich außer der "Frage" nach dem Grund für die permanente Kleinschreibung keine Stelle, wo jemand angeschrien wurde.

Aber lassen wir das mit der Frage, wer hier wie falsch reagiert hat und wer sich nur "verteidigt", doch einfach mal beiseite ... wenn Du mir zustimmst, daß der Wikipedia-Artikel zum Thema "Kleinschreibung" stimmt und auch die dort angegebenen Quellen bzw. das aus den Quellen gezogene Fazit, dann wirst Du ja auch attestieren müssen, daß die beiden dort beschriebenen Studien - auch wenn sie für Fremdsprachler zu diametral verschiedenen Ergebnissen kommen - für Muttersprachler und andere "Deutschkundige" auch feststellten (und zwar beide), daß deren Lesefluß durch die ausschließliche Kleinschreibung ausgebremst wurde:
Eine Gemeinsamkeit diverser Studien ist, dass Deutschleser, die das Lesen mit der Substantivgroßschreibung deutscher Texte gelernt und automatisiert haben, bei Texten mit der ihnen unvertrauten Kleinschreibung im Schnitt geringfügig langsamer lesen.
(Ich zitiere eigentlich nur ungern aus der Wikipedia, weil auch die Qualität der Artikel dort sehr weit gestreut ist.)

Wieviel jetzt "geringfügig" genau ist, kann man auch nicht anhand der Quellenangaben in der Wikipedia einschätzen, weil da nur Quellen angegeben wurden, die nicht online zu erreichen sind.

Aber das kann man im Selbstversuch eigentlich auch sehr schnell ermitteln ... man braucht sich nur mal die (hier fachlich oft verwendeten) Abkürzungen ansehen und was/ob es für einen selbst einen Unterschied macht, wie diese geschrieben werden. Für mich persönlich kann ich jedenfalls sehr deutlich festhalten, daß ich Wörter wie WLAN, VPN, DECT, SSL, TLS, SSH, etc. deutlich besser auf einen einzigen Blick und praktisch "ohne Lesen" erfassen kann, als deren pendants in kleiner schreibweise, wo ich ungleich länger und unter umständen auch mehrmals auf ein solches wort schauen muß, um seinen sinn zu erkennen: wlan, vpn, dect, ssl, tls, ssh - und da bin ich bei der kleinschreibung in diesem beispiel schon mental darauf vorbereitet, was da gleich kommen wird, während mir das in irgendeinem beliebigen satz sehr unerwartet vor die füße geworfen wird.

Ich kann also nicht für alle schreiben (und das will ich auch gar nicht) ... aber ich kann und will eine Lanze dafür brechen, daß man sich auch hier an die gängigen Regeln hält, weil es denen, die diese Regeln tatsächlich beherrschen (und wenn Du Korrespondenz in anderen Fällen auch in korrekter deutscher Groß- und Kleinschreibung führst, dann scheitert es ja nur am Willen und nicht am Können), das Lesen erleichtert - und sei es nur, weil sie es so mal gelernt haben (wobei das auch heutige Schüler ja noch genauso lernen (sollten), so daß das auch kein Problem ist, was sich mit der Zeit schon irgendwie "verwächst" - wie die alte deutsche Rechtschreibung vor 1996, die wohl die meisten der hier versammelten Leser noch gelernt haben).

Das mit dem "liest sich leichter" ist ja nun auch nicht nur eine leere Behauptung irgendwelcher Pedanten ... das Argument: "Es lernte sich leichter." für die Kleinschreibung mag zwar auch richtig sein, aber solange sich das nicht auch so weit durchgesetzt hat, daß die Leute tatsächlich von Kindesbeinen an diese Form erlernen (und da rede ich dann auch von illustrierten Bilderbüchern, in denen die Texte dann dieser Schreibweise folgen), wird es immer beim Konjunktiv II/Präsens von "lernen" dabei bleiben (Indikativ/Präteritum kann es ja nicht sein, weil es so bisher nicht gelehrt wurde).

Wenn Du das als "künstlerische Freiheit" sehen willst, sei Dir das auch unbenommen ... aber dann sollte es Dir/dem Künstler ja erst recht ein Bedürfnis sein, seine Sichtweise mit anderen so zu teilen, daß er sie auch "mitnimmt" in seine Welt und das wirst Du mit dem Hinweis auf Deinen Großmut bei mangelnder Rechtschreibung auch eher nicht erreichen.

Jetzt, wo das abgetrennt ist, kann man das ja auch noch weiter diskutieren ... aber nur, wenn jemand tatsächlich Lust dazu hat (nur immer "Technik" ist ja auch eher monoton) und nicht weiter als "Verteidigung" oder "Angriff". Ich denke mal, dazu wären die bisher bestehenden Unklarheiten dann ausgeräumt und es ist am Ende auch egal, wie es dazu kam.
 
Zuletzt bearbeitet:

schwester

Mitglied
Mitglied seit
22 Mrz 2011
Beiträge
424
Punkte für Reaktionen
23
Punkte
18
Interessante Diskussion. Aber ich werde mich hüten, Stellung zu beziehen. Rechtschreibfehler passieren, ein "Komma" wird auch mal vergessen. Und auf den Inhalt kommt es an.
Allerdings wenn ich merke, daß dies (aus welchen Gründen auch immer) gewollt geschieht, dann breche ich das Lesen des Beitrags ab, da es seeehr anstrengend ist den Sinn zu verstehen, wenn alles kleingeschrieben und/oder ohne Interpunktion ist.

Gruß S
 

Novize

Moderator
Teammitglied
Mitglied seit
17 Aug 2004
Beiträge
21,433
Punkte für Reaktionen
235
Punkte
63
Zur Vorgabe hier im Forum machen wir es uns an dieser Stelle doch ganz einfach:
Die von allen abgenickten Regeln geben folgendes vor:
IP-Phone-Forumsregeln schrieb:
5.8 Keine Wörter oder Sätze komplett in Großbuchstaben (wird als SCHREIEN interpretiert) und keine Verwendung von vielfachen Ausrufe- bzw. Fragezeichen. Die allgemein geltende Rechtschreibung ist einzuhalten.
Da gibt es formell nicht viel zu diskutieren, die geltende Groß- Kleinschreibung gehört nämlich dazu...
Da spielt es auch keine Rolle, wenn die Schreierei / durchgehende Großschreibung explizit hervorgehoben wird. Dies bedeutet im Umkehrschluss nicht, dass durchgehende Kleinschreibung akzeptiert wird. ;)
Dann noch ein technische Betrachtungsweise zur gemeinsamen Nutzung der deutschen Sprache:
Die deutsche Rechtschreibung ist Freeware, du darfst sie kostenlos nutzen – Aber sie ist nicht Open Source, d. h. du darfst sie nicht verändern oder in veränderter Form veröffentlichen.
Und hier einmal >ein paar Gedanken< zum Miteinander im Internet, wie man miteinander umgeht, dass es auch dort Respekt und Höflichkeit dem Gegenüber gibt. Von der Netiquette will ich erst garnicht anfangen. Die allgemein anerkannte und von quasi 95% genutzten Schreibweise incl. der hier üblichen Nutzung der Shift-Taste den Regeln nach sollte dabei selbstverständlich sein.
Wir sind es bei der deutschen Sprache alle so gewohnt, haben es genau so gelernt, wir sollten es allen anderen Lesern entsprechend auch nicht schwerer machen, als nötig.
Bedenke: Du bist einer, der das einmal runter tippert, es sind aber hunderte oder gar tausende Leser, die das dann irgendwie entschlüsseln müssen. Ich meine damit: Lesen, im Kopf sortieren, umformatieren, Großschreibung an den richtigen Stellen einpflegen, um es dann auch vernünftig verstehen zu können - muss das wirklich sein?
Nur, weil eine einzige Person sich das Recht heraus nimmt, gegen den Strom schwimmen zu wollen, anders sein zu wollen?
Schreibe ein Buch, nimm Dir da die künstlerische Freiheit, alles klein zu schreiben, das ist okay, da gilt dann nicht die Rechtschreibung mit der Groß- Kleinschreibung.
Aber hier, wie auch auf allen anderen Plattformen, auf denen Du zu Gast bist, solltest Du Dich den Gepflogenheiten unterordnen, Dich in die Gesellschaft einfügen, also in der Schriftform so schreiben, wie alle anderen auch.

es sei denn, Du meintest die ausschließliche Großschreibung vor der (ggf. auch rhetorischen) Frage
Das sehe ich auch nicht als Anschreien an sondern eher als das klassische Verhaltensmuster eines Hofnarren:
Dem Gegenüber den Spiegel für sein eigenes Verhalten vorhalten.

Rechtschreibfehler passieren, ein "Komma" wird auch mal vergessen. Und auf den Inhalt kommt es an.
Genauso handhaben wir das auch. Wir sind in keinem Literatur-Leistungskurs-Forum. Darum geht es nicht. Es gibt auch ausreichend Regeln, die mehr als mühsam zu begreifen sind, da sind Fehler vorprogrammiert, sei's drum...
Man sollte aber zumindest halbwegs fehlerfrei schreiben, das gebietet schon der Respekt allen Lesern gegenüber.

geschäftsbriefe werden natürlich der deutschen grammatik entsprechend geschrieben
Ganz pragmatische Lösung für das Dilemma: Du kannst es, also mache es, denn diese Grammatik/Rechtschreibung gilt hier ebenso ;)
 
Zuletzt bearbeitet:

sonyKatze

Aktives Mitglied
Mitglied seit
6 Aug 2009
Beiträge
2,520
Punkte für Reaktionen
225
Punkte
63
Im IP-Phone-Forum sind einige selbst-ernannte Rechtschreib-Polizisten unterwegs. Keine Ahnung warum man dieses Verhalten seit Jahrzehnten gewähren lässt. Wichtig ist, dass man den Anderen versteht. Schön wäre, wenn das so einfach wie möglich ginge. Jeder will verstanden werden, aber nicht jeder kann sich gleich gut ausdrücken. Und Manche stellen sich selbst ein Bein, weil sie meinen über Jahre, Jahrzehnte, Jahrhunderte gewachsene Konventionen – die einfach Verstehen einfacher machen – zu ignorieren. Kurz: Ist ja schön, dass einige hier anderen Sprach-Tipps geben, warum das aber öffentlich passieren muss und nicht über eine private Unterhaltung geschehen kann … mir ein Rätsel.
 

Novize

Moderator
Teammitglied
Mitglied seit
17 Aug 2004
Beiträge
21,433
Punkte für Reaktionen
235
Punkte
63
Im IP-Phone-Forum sind einige selbst-ernannte Rechtschreib-Polizisten unterwegs. Keine Ahnung warum man dieses Verhalten seit Jahrzehnten gewähren lässt.
Bitte bleibe sachlich. Keiner hier meckert wegen eines vergessenen Punkte, Kommas. Keiner beschwert sich über eine mal vergessene oder 2 Buchstaben lang gedrückte Shift-Taste. Hier ist definitiv kein "Polizist" unterwegs.
Und weiter: Wichtig ist, sich zu bemühen, halbwegs korrekt zu schreiben, dass die anderen einen so gut wie möglich verstehen, das nämlich schließt die Rechtschreibung ein.
Jeder will verstanden werden, aber nicht jeder kann sich gleich gut ausdrücken
Komisch, gerade das wurde hier nicht diskutiert und bemängelt - es geht nicht um die literarisch perfekte Kunstform, es geht um das Mindestmaß, was ein jeder zu bewältigen vermag und diese Latte hängt natürlich bei jedem anders...
Wer sich über mangelnde Rechtschreibung des andern beklagt, obwohl es offensichtlich ist, dass der <andere> das nicht besser kann, der bekommt ein paar auf die Finger. Es ist also genau anders herum, als Du es bemängelst
warum das aber öffentlich passieren muss und nicht über eine private Unterhaltung geschehen kann … mir ein Rätsel.
Warum Du dann hier öffentlich mit philosophierst ist mir hingegen ein Rätsel. Interessiert es Dich nicht, lies einfach still mit oder überlies es und gut ist. Betrachte die gesamte Geschichte ab dem Anlass, dem erst einmal kurzen Widerspruch und den dann immer länger werdenden Diskussionsbeiträgen dazu - es hat sich einfach aufgebauscht, zu einem eigenen Themenstrang entwickelt.
Daher hat DM41 es ja auch abgetrennt, damit es hier besser, wenn gewollt, diskutiert werden kann. Warum muss das denn hier verboten werden? Wer sagt denn, dass hier m gesamten Forum nur über vorgegebene VoIP-Themen oder Dir genehmen anderen Themen diskutiert werden darf?

Und last but not least:
Es ist manchmal gut, so etwas öffentlich zu diskutieren, wie auch andere Dinge einfach mal öffentlich anzumerken, andere auf etwas hinzuweisen: Diese Hinweise lesen viele Leute und das sorgt dafür, dass auch diese Leute sich das im Vorfeld zu Herzen nehmen.
Und manchmal lesen die angesprochenen User die an sie gesandten Foren-Hinweise Glocke-2.png nicht, ignorieren diese oder was auch immer. Dann hilft es nicht, dann muss man auch mal deutlicher werden.
 
  • Like
Reaktionen: Charlies Tante

sonyKatze

Aktives Mitglied
Mitglied seit
6 Aug 2009
Beiträge
2,520
Punkte für Reaktionen
225
Punkte
63
Warum Du dann hier mit philosophierst …
Äh. Ne. Es geht darum, dass User öffentlich wegen solchen Dingen angesprochen werden. Und auch ich werde hier am laufenden Meter wegen Rechtschreib-, Tipp- und Link-Fehler öffentlich getadelt. Und ich gebe mir Mühe. Mir wurscht. Ich freue mich über die Hinweise, wenn sie was beitragen. Aber das hätte man jedesmal auch über eine private Unterhaltungen machen können. Jetzt stehen in den Threads lauter Rechtschreib-Korrekturen.

Genau wie in dem Fall hier. Hätte man nicht öffentlich darauf hingewiesen, hört man irgendwann einmal zu. Macht man das öffentlich, läuft das Gefahr, dass
  • lediglich einer und nicht mehrere andere User meckern
  • derjenige sich öffentlich wehrt (und damit der Thread entgleist).
Es ist manchmal gut …
Und manchmal schlecht. Menschen, die nicht gut in Deutsch (oder Typographie oder Erklären) sind und erstmal bei uns Passiv-Leser sind, werden so massiv davon abgehalten sich jemals aktiv zu beteiligen. Wenn ein Einzelner meint – mit Absicht –, Jahrhunderte lange Erfahrungen über Bord werfen zu müssen/wollen, hat niemand etwas davon, wenn wir dem Einen öffentlich auf die Mütze geben.

Niemand (mit einem technischen Problem der eine Lösung sucht) kommt hierher und will absichtlich nicht verstanden werden.
es geht um das Mindestmaß
Es gibt eben kein Mindestmaß bei Verstehen. Ich habe schon die komplexesten Dinge mit Hand und Fuss gelöst.
dass der <andere> das nicht besser kann
zorro0369 kann es nicht besser, weil er es mit Absicht macht.
 

Joe_57

IPPF-Promi
Mitglied seit
5 Mrz 2006
Beiträge
6,031
Punkte für Reaktionen
159
Punkte
63
Vielleicht sollte @zorro0369 mal mit seinem Schreibstil versuchen, die Umschaltung zwischen den beiden FRITZ!Box-Partitionen zu beschreiben.
Aber bitte ohne Zitate, eingefügte Grafiken oder sonstige Querverweise zu verwenden!
 

B612

Mitglied
Mitglied seit
30 Jan 2021
Beiträge
744
Punkte für Reaktionen
137
Punkte
43
dannaberbitteauchnochohneleerzeichensonstbringtesnichts. :)
 
  • Like
Reaktionen: Olaf Ligor

Novize

Moderator
Teammitglied
Mitglied seit
17 Aug 2004
Beiträge
21,433
Punkte für Reaktionen
235
Punkte
63
Und auch ich werde hier am laufenden Meter wegen Rechtschreib-, Tipp- und Link-Fehler öffentlich getadelt.
Wo am laufenden Band? Das ist mir entgangen...
Aber das hätte man jedesmal auch über eine private Unterhaltungen machen können.
Glaube mir, das habe ich oft genug probiert, das ist oft fruchtlos. Warum wohl werden sonst auch die oben genannten Hinweise denn laufend ignoriert?
Hätte man nicht öffentlich darauf hingewiesen, hört man irgendwann einmal zu.
Nach 1 Mal oder erst nach hundert Malen? Nee, ein paar Ansagen müssen reichen, wir sind nicht im Kindergarten, wo sich jeder auf Kosten der anderen ausleben kann, wie es ihm gerade beliebt. Das widerspricht dem Gesellschaftsgeist.
Schau mal, wie oft mein Hinweis in den einzelnen Beiträgen steht. Immer wird ein Hinweis zum User geschickt, der diese oft genug tapfer ignoriert. :(
dass
  • lediglich einer und nicht mehrere andere User meckern
  • derjenige sich öffentlich wehrt (und damit der Thread entgleist).
kann ich nicht nachvollziehen, meiner Meinung nach ist Punkt 1 genau anders herum. Bei Punkt 2 schreitet ein Mod ein und sortiert aus, wie z.B. hier geschehen, um diesem Thema eine Plattform zu bieten. Aber Du sprichst Dich ja dagegen aus, weil es nicht in diese Forum passt. Wird statt dessen gelöscht, um zum Thema zurückzuführen oder eine Ansage im Thread gemacht, wird die Zensurkeule ausgepackt. Wie man es macht, ist es scheinbar falsch. :(
Und manchmal schlecht. Menschen, die nicht gut in Deutsch (oder Typographie oder Erklären) sind und erstmal bei uns Passiv-Leser sind, werden so massiv davon abgehalten sich jemals aktiv zu beteiligen
Gegenbeispiel: Eine Ansage war mal: Ich liege gerade hier auf der Couch mit dem Tablet und habe keine Lust, die Shifttaste zu nutzen. Wenn jemand sich bemüht, wird das gesehen und anerkannt. so habe ich das schon oft gesehen.
Kann jemand besser englisch, dann wird halt in englisch diskutiert - so passiert es hier oft.
Niemand (mit einem technischen Problem der eine Lösung sucht) kommt hierher und will absichtlich nicht verstanden werden.
Leider gibt s immer wieder so Fälle, siehe das obige Beispiel von mir. Andere aber versuchen es und das alleine reicht
Es gibt eben kein Mindestmaß bei Verstehen. Ich habe schon die komplexesten Dinge mit Hand und Fuss gelöst.
zorro0369 kann es nicht besser, weil er es mit Absicht macht.
Doch, das Mindestmaß ist das, was man kann. Hier gibt es weder Hand noch Fuß, hier gibt es nur die schriftliche Form, garniert mit Bildern. Da ist gestikulieren nicht zielführend.
Zorro0369 kann es besser, er will einfach nicht. Das ist das Problem

EDIT:
Weil es so schön ist, hier noch eine Diskussion aus einem anderen Thread zu den Regeln, bevor es auch dort zu OT wird:

Novize, mach doch bitte immer auch ein konkretes Beispiel, damit man das für sich einfacher übersetzen kann, also z.B. hier: „GRP-Series an FRITZ!Box Registrar“.
Pardon, eine Zusammenfassung eines Textes lernt man in der Mittelstufe. Da kann jeder...
Wenn ich da jedes Mal ein Beispiel mache, wird immer genau dieses Beispiel ohne Nachdenken als Titel genommen ein Funken eigene Bemühung ist doch noch machbar, oder nicht?
 
Zuletzt bearbeitet:

NDiIPP

IPPF-Promi
Mitglied seit
13 Apr 2017
Beiträge
4,830
Punkte für Reaktionen
923
Punkte
113
... wenn alles kleingeschrieben und/oder ohne Interpunktion ist.
Oder auch ohne Absätze (wenn es nicht gerade ein Ein- oder "Wenigzeiler" ist). Da höre ich i.d.R. auch auf zu lesen, ist zu anstrengend.
 

zorro0369

Mitglied
Mitglied seit
25 Mrz 2018
Beiträge
406
Punkte für Reaktionen
94
Punkte
28
sorry @PeterPawn dass ich mich erst jetzt wieder melde, aber am Freitag musste ich noch 800km zu ner baustelle um 3 uhr früh, geht halt nicht alles über teams oder ähnlichem. Wollte deinen vorschlag dies hier in ruhe weiterzuführen mal aufgreifen, auch wenn sich schon einige dazu gemeldet haben (deswegen hab ich mich auch an meine 24std regeln mal selber gehalten).
Wie du feststellst, bleibe ich mal lieber bei der gemäßigtem kleinschreibung, da ich eigentlich auch davon ein verfechter bin.

Ein beispiel, und ich bitte jeden ehrlich mit sich selbst zu sein, der dies liest:

heute morgen
morgen früh
Dienstag abend

wie würdet ihr das schreiben (auflösung am ende dieses postes). Also nicht direkt ans ende schauen oder ne suchmaschine nutzen, sondern wirklich aufschreiben.

@Novize knappe 400 beiträge hab ich geschchrieben, davon maximal 2 als fragestellung und 1/4 mit positiven bewertungen. Noch nie hat mich irgendwer angeschrieben bezüglich groß-/kleinschreibung. Ich glaube auch nicht, dass ich mich nicht verständlich ausgedrückt hätte und irgendwer probleme hat mich zu verstehen. Nun kommen wir aber zum eigentlichem problem der fragestellung.
Was sind die allgemein gültigen regeln der deutschen sprache? Wer gibt sie vor?
Der letzte Wille wird klein geschrieben, aber die Letzte Ölung, das Letzte Gericht, der Heilige Vater wird groß geschrieben. da haben nämlich kultusminister und klerus das letzte Wort gehabt (ja richtig, wird klein geschrieben).
Ein Carsten Scheibe mag einen schönen text geschrieben haben, doch schon in der überschrift nutzt er den "deppenbindestrich". Der ist nicht verboten, doch bekommt er dafür bei germanisten einen ausdrucksfehler. Kann er auch nicht wissen (oder muss es nicht), da er nie ein voluntariat als journalist gemacht hat oder Germanistik studiert hat. Sieht man ganz deutlich, wenn er die 3 Pünktchen erwähnt. Heinrich Bölls erste veröfftlichung endete mit "...". Übrigens war auch Böll mindestens der gemäßigtem rechtschreibung zugetan. Mal davon ab, dass der text von 2005 ist und somit ziemlich veraltet, außer du beziehst dich auf dein anderes zitat :

Die deutsche Rechtschreibung ist Freeware, du darfst sie kostenlos nutzen – Aber sie ist nicht Open Source, d. h. du darfst sie nicht verändern oder in veränderter Form veröffentlichen.
, welches erstens von wem mit rang stammt? Und zweitens in sich schon nicht stimmig ist, auch wenn es sich super anhört. Da der Duden freeware als veränderbare software bezeichnet und es wird sich ja auch auf den Duden bezogen.
Ach so, Duden, na der macht sich gerade mal so richtig obsulet. Sprachwissenschafter laufen gerade sturm gegen ihn und die chefredakteurin des Dudens sagt nun:
„Der Duden hat keine Sprachmacht oder Sprachgewalt, ....“
Aber selbst Konrad Duden war ein Anhänger der Phoenetik, sprich: schreibe so, wie du sprichst.
Wie ich weiter oben aufgeführt habe, hat 1840 Grimm ein werk herausgebracht für die gemäßtigte kleinschreibung. Warum?. Die deutsche sprache ist eine germanische. Doch die besonderheit in ihr ist ihre grammatik, die ist nämlich lateinisch. so wurde auch über jahrhunderte die gemäßigte kleinschreibung vollzogen. Erst im Barock (16./17. Jahrhundert) entschied man sich zur großschreibung. Der Absolutismus und Klerikismus lässt grüßen. Es wurde befohlen. Die normalen menschen schrieben weiter so wie gehabt.
Danach kamen immer mehr dichter und denker die dieses wieder rückgängig machen wollten, aber genau am deutschem problem scheiterten. Obrigkeitsdenken.
1876 war eigentlich schon entschieden, dass man zur gemäßigten kleinschreibung zurückkehren will, doch scheiterte die kommision am widerstand der herrscher.
1901 sollte ähnliches geschehen, doch mit so einem kaiser war halt kein staat zu machen... *ironie off*.
1996 eigentlich gleiche spiel in grün, da haben sogar mehrere mitglieder deswegen die komission verlassen.

Ergo, wir schreiben nicht seit jahrhunderten groß. Im Barock nur die herrscher, danach ca mitte des 19.jahrhunderts dann alle.



Genau wie in dem Fall hier. Hätte man nicht öffentlich darauf hingewiesen, hört man irgendwann einmal zu. Macht man das öffentlich, läuft das Gefahr, dass
  • lediglich einer und nicht mehrere andere User meckern
  • derjenige sich öffentlich wehrt (und damit der Thread entgleist).
Da musst du dir bei mir keine sorgen machen, eigentlich antworte ich PeterPawn, der mir sehr angenehm eine schöne diskussionsgrundlage darbot ;). Auf polemische komentare gehe ich heute nicht ein.

Ich kann sonyKatze nämlich beipflichten, es ist mir schon des öfteren aufgefallen das er deswegen "angesprochen" wird. Nett ist anders. Deswegen möchte ich mich auch bei @Olaf Ligor entschuldigen, für meine (PeterPawn meinte kindisch) überzogene, an dem abend dumme, art ihn anzugehen.
Manchmal frage ich mich, wo unsere toleranz hingekommen ist? Was heißt eigentlich deutsch? Selbst darüber sind sich sprachwissenschaftler nicht einig.

Und nun die auflösung :

heute Morgen
morgen früh
Dienstagabend

lg zorro
 
  • Like
Reaktionen: PeterPawn

Novize

Moderator
Teammitglied
Mitglied seit
17 Aug 2004
Beiträge
21,433
Punkte für Reaktionen
235
Punkte
63
Auf polemische komentare gehe ich heute nicht ein.
Dann fange nicht selbst mit so etwas an! Deine Beispiele oben sind nichts weiter als Nebelkerzen, denn um eine einzelne Groß/Kleinschreibung ging es hier nicht, wie schon vielfach nachlesbar. Vielleicht solltest auch Du Dir mal die Mühe machen, die anderen Beiträge diesbezüglich noch einmal zu studieren. Nebenbei "Letzte Ölung" usw sind fest Begriffe und daher als Ganzes als Subjektiv zu sehen, der Klerus hat da schon lange nichts mehr zu melden, das Mittelalter ist vorbei...
Manchmal frage ich mich, wo unsere toleranz hingekommen ist? Was heißt eigentlich deutsch? Selbst darüber sind sich sprachwissenschaftler nicht einig.
Machen wir es kurz, bevor ich alles so zerlege und in falsche Zusammenhänge bringe, wie andere Beiträge es hier zeigen:
Deine Toleranz hört scheinbar da auf, wo Du Dich in die Gemeinschaft einordnest. Genau da forderst Du von anderen, Dein Fehlverhalten zu tolerieren, statt neben den Gepflogenheiten dieses Forums und seiner Gesellschaft auch die geltende Rechtschreibung zu tolerieren!
Deutsch (schreiben/nutzen) heißt, die geltenden Regeln zu akzeptieren und auch einzuhalten. Alles andere aus Deiner Fragestellung ist verschwurbelter Mist, den man von allen Verweigerern anderer Themen auch identisch mitbekommt. Da geht dann bis hin zu Verschwörungsgläubigern, wie wir ja auch aktuell immer wider draußen mitbekommen. Der Ansatz derer Entgegnungen ist immer, die, die Du hier zum besten gibst, indem Du Dinge, die völlig selbstverständlich sind, Dir aber nicht in den Kram passen, hinterfragst, um sie zu diskreditieren und abzuwerten.
Da steckt doch bestimmt die NWO dahinter, die uns damit irgendwie ausrotten will. o_O (scnr)

Mal Spaß beiseite:
Es interessiert nicht, was ein einzelner ausgeklinkter "Sprachwissenschaftler" (wahrscheinlich im wahren Beruf Kochbuchautor oder Schlagersänger (beide haben tatsächlich schon mal was mit deutschen Texten zu tun gehabt, sind also ausgewiesene Experten) von sich gibt. Die überragende Mehrheit derer ist an der Einhaltung der anerkannten Regeln interessiert, Du solltest Dich da auch an die Mehrheit halten, kleine Revoluzzer sind hier nicht gefragt.
Mehr gibt es dazu nicht zu sagen, die Forusmregeln, die AGBs, die Nutzungsbedingungen, die auch Du abgenickt hast, geben das vor, also halte Dich an den damit abgeschlossenen Vertrag!
 
  • Like
Reaktionen: weißnix_

PeterPawn

IPPF-Urgestein
Mitglied seit
10 Mai 2006
Beiträge
13,764
Punkte für Reaktionen
1,260
Punkte
113
Auch wenn ich das hier vom Zaun gebrochen haben mag ... ich finde die Haltung, sich bei @Olaf Ligor zu entschuldigen, weil die Reaktion wohl nicht angemessen war, absolut in Ordnung, da (beim Zugeben, daß man selbst auch Fehler machen kann) unterscheiden sich dann die Männer von den Jungs - dafür gab's von mir auch das "Däumchen".

Und auch wenn ich die Kleinschreibung persönlich nicht in Ordnung finde, bin ich durchaus bereit, eine Diskussion über begründete Einwände gegen die Groß- und Kleinschreibung zu führen und das war es auch, was ich in #7 am Ende angesprochen habe.

Und in diesem Kontext, finde ich den Tenor von #18 dann wieder fehl am Platze ... das klingt mir zu sehr nach einem ehemaligen Bundeskanzler (die meisten werden den Basta-Schröder ja noch kennen) und nach dem "Abwürgen" einer Diskussion, für das es - in diesem Thread, der ja nun extra dafür abgetrennt wurde - nach meinem Dafürhalten keinen Grund gibt.

Man mag ja anderer Meinung als @zorro0369 sein, aber dann kann bzw. sollte man seine eigene Meinung auch so formulieren können, daß daraus eben nicht sofort wieder eine "Verurteilung" wird und das kann ich - nur als Beispiel - in diesem Absatz eben genau nicht erkennen:
Deine Toleranz hört scheinbar da auf, wo Du Dich in die Gemeinschaft einordnest. Genau da forderst Du von anderen, Dein Fehlverhalten zu tolerieren, statt neben den Gepflogenheiten dieses Forums und seiner Gesellschaft auch die geltende Rechtschreibung zu tolerieren!
Denn wenn man noch einmal nachliest, kann ich beim besten Willen nicht entdecken (nach der "Rücknahme" des "ich toleriere ja auch falsche Rechtschreibung"-Arguments), wo @zorro0369 seinerseits nicht bereit war/ist, die geltende Rechtschreibung zu tolerieren, was ja nicht zwangsläufig damit gleichzusetzen ist, daß er sie auch selbst nutzt (und ich betone auch gerne noch einmal ausdrücklich, daß ich das persönlich auch besser fände - damit das niemand falsch verstehen oder auch nur (absichtlich) falsch interpretieren kann).

Auch wenn ich #9 noch unterschreiben würde, weil das als "Eingangsstatement" den Deinen eigenen Standpunkt verdeutlicht - das in #18 hat für mich nichts mehr mit "Diskussion" zu tun. Denn es geht da unmittelbar zu "ad personam" über, wenn das (argumentativ begründete) Ablehnen der Groß- und Kleinschreibung gleich auf andere Lebensbereiche ausgeweitet wird, indem man dem Opponenten noch alle möglichen anderen, vom überwiegenden Teil des Publikums als "unredlich" angesehenen, Beweggründe unterstellt.

Und ich sehe hier weder für Deine Argumentation "das kennt man schon von anderen", noch für die Unterstellung "indem Du Dinge, die völlig selbstverständlich sind, Dir aber nicht in den Kram passen, hinterfragst, um sie zu diskreditieren und abzuwerten" (und man kann durchaus auch GEGEN etwas sein, ohne das zu diskreditieren und abzuwerten, wobei das schon per se sehr ähnliche Bedeutungen sind) einen begründbaren und schon gar keinen (von Dir) begründeten Anlaß.

Eine Argumentation, die auf ein "Leute Deines Schlages" abzielt, was in dem Satz mit dem "verschwurbelten Mist" (auch eine sehr provokante Abwertung der Argumente des Gegners und nicht wirklich eine Widerlegung) am Beginn ja auch "angedeutet" wird (und das ist fast noch untertrieben), hat ja mit einer ernsthaften Befassung mit den Argumenten des Opponenten und deren gezielter Widerlegung nichts zu tun.

Ja, man könnte sogar der Ansicht sein, daß der Schlenker zur "Neuen Weltordnung" (auch wenn er mit einem SCNR "entschärft" wurde) eher dazu geeignet wäre, den Opponenten hier zu diskreditieren (und zwar auch gezielt), indem man ihn in eine Reihe mit irgendwelchen Spinnern (und auch das ist meinerseits wertend) stellt und damit versucht, nicht seine Argumentation, sondern seine Person (bzw. seine Haltung/Idee) an sich, lächerlich zu machen.

Sorry ... aber so diskutiert man eben auch nicht und selbst wenn Du von ständigen Auseinandersetzungen mit anderen im Rahmen der Moderationstätigkeit (und teilweise ja auch in diesem Thread) "genervt" sein könntest, ist das in meinen Augen noch lange kein Grund, hier in dieser Form aufzulaufen. Dann trennt einfach die zusätzliche Diskussion (primär ja wohl mit @sonyKatze) noch einmal von diesem Thread ab, denn die hat mit der Behauptung einer "Foren-Polizei" auch nichts mit der hier eigentlich thematisierten generellen Groß- und Kleinschreibung in der deutschen Sprache zu tun - vielleicht sollte man dann auch den Titel noch einmal korrigieren und das "im Forum" streichen ... zum Zeitpunkt der Abtrennung (die erfolgte nach #6) war das ja schon um einiges von diesem "im Forum" entfernt und da muß man das jetzt nicht auf diesen Aspekt verkürzen, was dann wieder - m.E. fälschlicherweise - mit den "Forenregeln" verknüpft würde und mit diesen kollidieren könnte.



EDIT:
Und um auch zu den Argumenten von @zorro0369 noch einen "Schnellschuß" zu bringen, obwohl ich das eigentlich in Ruhe machen wollte:

Ein "Schreibe so, wie Du sprichst." hat nicht zwangsläufig etwas mit der Frage der Groß- und Kleinschreibung zu tun, denn die Verwendung von Majuskeln ist dem gesprochenen Wort ja nicht anzumerken.

Auch die Anmerkung:
Erst im Barock (16./17. Jahrhundert) entschied man sich zur großschreibung. [...]Die normalen menschen schrieben weiter so wie gehabt.
ist etwas "aus der Luft gegriffen" in meinen Augen, denn die "normalen Menschen" schrieben damals überwiegend gar nicht - schon weil sie es nicht konnten.

Und aus jedem Verfechter der Beibehaltung von Groß- und Kleinschreibung gleich einen Diederich Heßling zu machen, ist auch deutlich übertrieben, ja, selbst ein:
Danach kamen immer mehr dichter und denker die dieses wieder rückgängig machen wollten, aber genau am deutschem problem scheiterten. Obrigkeitsdenken.
vor dieser Feststellung ist eher "verschleiernd", denn unter "immer mehr" ist eben trotzdem noch keine Mehrheit zu verzeichnen. Wieviele sind denn "immer mehr"? Erst eins, dann zwei, dann drei, dann vier ... dann steht die (Schreib-)Reform vor der Tür?

Aus einer - nach wie vor eher kleineren - Anzahl von Befürwortern einer Reform jetzt gleich ein ganze Armee von Protagonisten einer solchen Reform zu machen, wird auf diesem Wege jedenfalls auch nicht gelingen ... das bleibt trotzdem nur ein Scheinriese. Und auch wenn (zumindest in der Wikipedia) behauptet wird, die Kommission zur Reform 1996 hätte weit überwiegend die Kleinschreibung einführen wollen und das wäre an "politischem Widerstand" gescheitert - Fakt ist nun mal auch, daß diese Kommission von Beginn an gar kein Mandat (aus der Politik) hatte, generell die GKS zu reformieren und es einfach doch in Angriff nehmen wollte (http://www.sprachforschung.org/ickler/index.php?show=news&id=301). DAS würde im Aufsatz auch mit "Thema verfehlt" getadelt - und heutzutage (wo - idealisiert - jeder Mensch lesen und schreiben kann) reicht definitiv "eine Kommission" und deren Mitglieder (die sich ja auch jeweils "selbst verwirklichen" wollten und unter denen es auch genug Konflikte gab, siehe weitere Einträge im oben verlinkten "Tagebuch", wobei auch dessen Autor nicht ohne eigene Interessen oder Ideen oder Vorlieben und das schon ein deutlich "persönlich gefärbtes" Tagebuch ist) auch nicht mehr aus, um so tiefgreifende Einschnitte in das Leben (und die Schriftsprache gehört nun mal dazu) vorzunehmen.

Wie wenig schon die (letztlich kompromißbasierten) Reformen der jüngsten Vergangenheit (damit meine ich ab 1996) in der Bevölkerung akzeptiert werden, sieht man ja auch daran, daß sich auch diese noch lange nicht wirklich durchgesetzt haben - es gibt immer noch genug Leute (ich gehöre dazu), die heute dann eben in einer Mischung aus alter und neuer Orthographie schreiben. Und mir jetzt (zumindest indirekt) "Obrigkeitsdenken" unterzujubeln, weil ich der Ansicht bin, daß es eine solche Reform gar nicht braucht (obwohl es schon immer bei den Reformversuchen sowohl Befürworter als auch Gegner gab, auch wenn Du letztere offensichtlich "unterschlagen" willst bei der Argumentation), ist genauso fehl am Platze, als wenn Du den Unterzeichnern der Frankfurter Erklärung (https://web.archive.org/web/20190722090656/http://won.mayn.de/rechtschreibreform/n-fra-e.html) etwas derartiges als Motivation unterstellen würdest.

Die deutsche Sprache (und auch die GKS darin) hat auch eine Geschichte und die gesamte Aufklärung (in Deutschland) schrieb - bis auf sehr wenige Ausnahmen, was genauso "unkonkret" ist wie Dein "immer mehr" - in dieser Form (bzw. der damals gebräuchlichen) und es hat ihnen auch nicht wirklich geschadet - selbst wenn ich bereit bin zu attestieren, daß es auch dort eher um die Inhalte als um die Form ging. Trotzdem ist auch die GKS damit ein "Kulturgut" geworden und ob man sich so ohne weiteres und mit einer gewissen Nonchalance davon trennen will (oder sollte), können eben nicht einfach so einzelne Personen "entscheiden" ... sie können es höchstens befürworten und dann sehen, ob sie für ihre Position eine Mehrheit finden. Bisher war das jedenfalls noch nicht der Fall - und auch ein Heinrich Mann (um den Bogen zum Hrn. Heßling zu schlagen) schrieb in der "üblichen GKS" (ich hoffe mal, daß diese Abkürzung auch ohne expliziten "Bezug" klar war, weil ich nun oft genug von "Groß- und Kleinschreibung" geschrieben hatte), ebenso wie viele andere der von Dir ins Feld geführten "Dichter und Denker". Diese jetzt alle als "obrigkeitshörig" zu klassifizieren, wird der Sache sicherlich auch nicht gerecht.

Ja, selbst in anderen Sprachen war (und ist) eine Großschreibung (und sei es nur zum Hervorheben von Wörtern) gebräuchlich (siehe das "Soldier" oder "Owner" im "3rd Amendment" der US-amerikanischen "Bill of Rights") ... ein weiteres Argument gegen eine konsequente Kleinschreibung, wie Du sie (zumindest bisher) praktiziert hast.
 
Zuletzt bearbeitet:

Novize

Moderator
Teammitglied
Mitglied seit
17 Aug 2004
Beiträge
21,433
Punkte für Reaktionen
235
Punkte
63
Denn wenn man noch einmal nachliest, kann ich beim besten Willen nicht entdecken (nach der "Rücknahme" des "ich toleriere ja auch falsche Rechtschreibung"-Arguments), wo @zorro0369 seinerseits nicht bereit war/ist, die geltende Rechtschreibung zu tolerieren, was ja nicht zwangsläufig damit gleichzusetzen ist, daß er sie auch selbst nutzt (und ich betone auch gerne noch einmal ausdrücklich, daß ich das persönlich auch besser fände - damit das niemand falsch verstehen oder auch nur (absichtlich) falsch interpretieren kann).
Er toleriert diese ja offensichtlich nicht, denn er lehnt diese bzw deren Gebrauch hier ab, er nutzt sie nicht. Ebenso lehnt er die Gepflogenheiten dieser Gemeinschaft ab, weil er sich eben nicht integriert und die geltenden Regeln akzeptiert (=selbst umsetzt). Alles andere von Dir sehe ich als extrem überinterpretiert an. Du liest da Dinge hinein, die so dort nicht stehen und auch nicht gemeint sind.
das in #18 hat für mich nichts mehr mit "Diskussion" zu tun. Denn es geht da unmittelbar zu "ad personam" über, wenn das (argumentativ begründete) Ablehnen der Groß- und Kleinschreibung gleich auf andere Lebensbereiche ausgeweitet wird, indem man dem Opponenten noch alle möglichen anderen, vom überwiegenden Teil des Publikums als "unredlich" angesehenen, Beweggründe unterstellt.
Wo fängt es an, wo hört es auf, die gesellschaftliche Basis in Teilen abzulehnen und das gesamte Gerüst Stück für Stück damit zu demontieren? Wo ist die Grenze des Hinnehmbaren zu ziehen? Warum dann genau da und nicht noch einen kleinen Schritt weiter?
Irgendwelche fadenscheinigen Pseudoargumente dafür, die Regeln nicht einzuhalten, gibt es in allen Lebensbereichen. Daher ja auch der Vergleich (nicht die Unterstellung!) mit den anderen Lebensbereichen, wo ähnlich krude argumentiert wird, um den eigenen Egoismus auf Kosten anderer auszuleben. In diesen anderen Lebensbereichen wird das ja wunderbar vor Augen geführt, wie das ausartet und welchen Schaden das für die gesamte Gesellschaft nimmt. Diesen extremen Vergleich habe ich bewusst genommen, um auf das abstrude Verweigern des gesellschaftlichen Konsens aufmerksam zu machen. Da ich ihm dieses Agieren in anderen Bereichen so nicht unterstellt habe, ist dieser Vorwurf mir gegenüber schäbig.
Nebulös anzudeuten, "irgendwelche Sprachwissenschaftler" würden das ähnlich sehen wie er, ist kein Argument, da kann man nichts abwerten. Das war ja der Aufhänger, um auf irgendwelche Schlagersänger und Co hinzuweisen, nicht greifbare Sprachwissenschaftler sind nun einmal genauso wenig definiert und dementsprechend zu hinterfragen, wie diese allerorten selbsternannten "Experten" aus dem Beispiel.
Der Hinweis zur NWO ist genau so zynisch gemeint, wie ich es mit dem Emoji und scnr geschrieben habe - da ist nichts "dadurch nur" entschärft, das ist lediglich eine abschließende Spitze hinsichtlich der bekannten Verhaltensmuster derjenigen, die ich mit dem Vergleich direkt davor andeutete. Bitte auch hier nichts in den falschen Hals bekommen und bewusst(?) falsch interpretieren. Bei der Wortwahl, den Unterstellungen und den unbelegten Behauptungen, die in seinem Beitrag stehen, dieser Steilvorlage, drängt sich dieser Vergleich ja förmlich auf:
Wenn so Sprüche kommen, wie "wir (als eingebildete Mehrheit) werden von den Herrschern in diesem Bereich unterdrückt", aber in Wirklichkeit sind sie eine sehr kleine Minderheit, die sich nicht im gesellschaftlichen Konsens einordnen wollen, dann schreit das förmlich nach einem Vergleich mit den anderen angedeuteten Lebensbereichen, wo ähnliche Mechanismen von einer kleinen Randgruppe seit Jahren genutzt werden. Das darf nicht mit dem vorgeblichen "Obrigkeitsdenken" verunglimpft werden sondern gehört zu der Gesellschaft, in der diese Personen selbst leben - ich kann es nicht oft genug wiederholen.
Sorry ... aber so diskutiert man eben auch nicht und selbst wenn Du von ständigen Auseinandersetzungen mit anderen im Rahmen der Moderationstätigkeit (und teilweise ja auch in diesem Thread) "genervt" sein könntest
Sorry, so zerlegt und miss-interpretiert man auch nicht meine Beiträge. ;)
Und nein, ich habe das nicht als Mod geschrieben, da gäbe es einfach schon weiter vorne eine knallharte Ansage ohne weitere Diskussion mit dem anschließenden Abschließen des Threads - das ist meine persönliche Meinung als Mensch und Teil dieser Gesellschaft hier - auch diese persönliche eigene Meinung solltest du mir zubilligen. warum sonst diskutiere ich hier mit - als Mod brauche ich das nicht. Als Mensch versuche ich, ein Einsehen der anderen zu erreichen. Das ist auch nicht genervt sondern lediglich fassunglos, wie einzelne sich der Gesellschaft und deren Regeln entziehen wollen.
Dann trennt einfach die zusätzliche Diskussion (primär ja wohl mit @sonyKatze) noch einmal von diesem Thread ab, denn die hat mit der Behauptung einer "Foren-Polizei" auch nichts mit der hier eigentlich thematisierten generellen Groß- und Kleinschreibung in der deutschen Sprache zu tun - vielleicht sollte man dann auch den Titel noch einmal korrigieren und das "im Forum" streichen ...
Forenpolizei, Rechtschreibpolizei... es geht doch um das selbe Thema. Ich finde, dass passt ganz gut zusammen, denn beides Mal geht es darum, dass sich User nicht den Gepflogenheiten und Regeln unterordnen wollen und meckern, wenn andere User wie auch Mods dieses Fehlverhalten kritisieren und die Mods das dann irgendwann auch noch per Ansage durchsetzen, weil es scheinbar nicht per Einsicht der User geht.
 
Zuletzt bearbeitet:
  • Like
Reaktionen: weißnix_

Erhalten Sie 3CX für 1 Jahr kostenlos!

Gehostet, in Ihrer privaten Cloud oder on-Premise! Ganz ohne Haken. Geben Sie Ihren Namen und Ihre E-Mail an und los geht´s:

3CX
Für diese E-Mail-Adresse besteht bereits ein 3CX-Konto. Sie werden zum Kundenportal weitergeleitet, wo Sie sich anmelden oder Ihr Passwort zurücksetzen können, falls Sie dieses vergessen haben.
oder via